Laboratory of Molecular Genetics of Microorganisms

All strains

Thermus brevis GM15

Genus
Thermus
Species
brevis
Strain
GM15
Cultivation medium
Castenholz medium
Cultivation temperature, °C
70
Genome size, bp
2 387 648
GC content, %
64.9
Assembly level
Large contigs
Isolation source
Dachnyye hot springs, Kamchatka
Received
September 1, 2025

Sequences

FileKindVersionSequencingAssemblerSize
TBRE_GM15_genome.gb.gzannotationMinION hybracter v0.10.01.5 MB

Replicons

Table (4)
IDNameTopologyLength, bpGC content, %
GM15_CHRchromosomecircular2 266 32765.0
pGM15_1plasmid pGM15_1circular111 62163.2
pGM15_2plasmid pGM15_2linear7 88270.6
pGM15_3plasmid pGM15_3linear1 81862.0

CRISPR-Cas systems

Table (2)
SubtypeRepliconCoordinates
III-Aplasmid pGM15_136 752–47 654
I-Bplasmid pGM15_179 891–88 300

III-Aplasmid pGM15_1 · 36 752..47 654 · 10 903 bp · 10 coding sequences

CRISPR array — 35 684..36 032 · 349 bp · repeat consensus: GTTGCAAGAGATGCTTCCCCGAAAGGGGATTGCGACCRISPR array — 41 271..41 702 · 432 bp · repeat consensus: GTTGCAAGAGATGCTTCCCCGAAAGGGGATTGCGACError-prone DNA polymerase — 33 684..34 533 (+) · 850 bp · partial framehypothetical protein — 34 497..35 306 (−) · 810 bphypothetical protein — 36 102..36 446 (+) · 345 bpCRISPR-associated endoribonuclease Cas6 — 36 752..37 495 (+) · 744 bpCRISPR-associated (Cas) DxTHG family protein — 37 508..38 713 (−) · 1 206 bpCsm6 6H domain-containing protein — 38 757..39 962 (+) · 1 206 bpCRISPR-associated endonuclease Cas1 1 — 39 962..40 906 (+) · 945 bpCRISPR-associated endoribonuclease Cas2 — 41 726..41 995 (+) · 270 bpCRISPR system Cms protein Csm5 — 42 100..43 227 (−) · 1 128 bpCRISPR system Cms protein Csm4 — 43 271..44 098 (−) · 828 bpCRISPR system Cms endoribonuclease Csm3 — 44 095..44 820 (−) · 726 bpCRISPR system Cms protein Csm2 — 44 824..45 228 (−) · 405 bpCRISPR system single-strand-specific deoxyribonuclease Cas10/Csm1 (subtype III-A) — 45 231..47 654 (−) · 2 424 bpPlasmid replication initiator protein — 48 167..49 654 (+) · 1 488 bp · partial frame

Integrative elements

Table (2)
NametRNARepliconCoordinatesLength, bp
IE1tRNA-Ilechromosome389 306–397 1967 891
IE2tRNA-Valchromosome576 396–591 00814 613

IE1chromosome · 389 306..397 196 · 7 891 bp · 12 coding sequences · 2 tRNAs

Attachment site — 389 306..389 382 · 77 bpMobile element — 389 306..397 196 · 7 891 bpAttachment site — 397 150..397 196 · 47 bpSite-specific integrase — 389 460..390 635 (−) · 1 176 bphypothetical protein — 390 635..390 757 (−) · 123 bphypothetical protein — 390 747..390 959 (−) · 213 bphypothetical protein — 391 230..391 523 (−) · 294 bpTransposase zinc-ribbon domain-containing protein — 391 510..392 037 (−) · 528 bphypothetical protein — 392 034..392 282 (−) · 249 bphypothetical protein — 392 269..392 889 (−) · 621 bpDNA primase/polymerase bifunctional N-terminal domain-containing protein — 392 880..394 799 (−) · 1 920 bpDNA primase/polymerase bifunctional N-terminal domain-containing protein — 394 830..395 693 (−) · 864 bpDNA-binding protein — 395 703..395 918 (−) · 216 bphypothetical protein — 396 002..396 757 (−) · 756 bpDUF1902 domain-containing protein — 396 787..397 008 (+) · 222 bpArabinose efflux permease family protein — 397 258..398 463 (−) · 1 206 bpHTH-type transcriptional regulator KmtR — 398 466..398 807 (−) · 342 bpInosine-5'-monophosphate dehydrogenase — 398 937..399 196 (+) · 260 bp · partial frametRNA-Ile(gat) — 389 306..389 382 (+) · 77 bptRNA-Leu(caa) — 397 115..397 196 (+) · 82 bp · pseudogene